ID: 1088803148_1088803159

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1088803148 1088803159
Species Human (GRCh38) Human (GRCh38)
Location 11:113325632-113325654 11:113325663-113325685
Sequence CCAACCGAGCCCAGGTCAGTGAG GTATCCATGGGGCTTTCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 103} {0: 1, 1: 0, 2: 0, 3: 4, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!