ID: 1088812336_1088812344

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1088812336 1088812344
Species Human (GRCh38) Human (GRCh38)
Location 11:113400152-113400174 11:113400183-113400205
Sequence CCCTGCAACTGGCCCTCCGCAGC GGGCATCATGTCCTTCCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 177} {0: 1, 1: 0, 2: 1, 3: 10, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!