ID: 1088812340_1088812344

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1088812340 1088812344
Species Human (GRCh38) Human (GRCh38)
Location 11:113400164-113400186 11:113400183-113400205
Sequence CCCTCCGCAGCCGAAAGCAGGGC GGGCATCATGTCCTTCCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 99} {0: 1, 1: 0, 2: 1, 3: 10, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!