ID: 1088812472_1088812486

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1088812472 1088812486
Species Human (GRCh38) Human (GRCh38)
Location 11:113400888-113400910 11:113400941-113400963
Sequence CCACCTTTTGCCACTCGCTTCTG CCCCCTCTGGAGATGGAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 35, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!