ID: 1088817026_1088817038

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1088817026 1088817038
Species Human (GRCh38) Human (GRCh38)
Location 11:113428446-113428468 11:113428486-113428508
Sequence CCAAAAACTGTCAGTTGCCAACA TGAGGGCTGTGGTCCTGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 177} {0: 1, 1: 0, 2: 3, 3: 37, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!