ID: 1088821835_1088821851

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1088821835 1088821851
Species Human (GRCh38) Human (GRCh38)
Location 11:113463331-113463353 11:113463383-113463405
Sequence CCATCTGTGGCCATTGGGCACGG CAGGGACGGGTCCCAGATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134} {0: 1, 1: 0, 2: 2, 3: 14, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!