ID: 1088821947_1088821956

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1088821947 1088821956
Species Human (GRCh38) Human (GRCh38)
Location 11:113464106-113464128 11:113464153-113464175
Sequence CCACTTGCCACCCTGTCTTCACC CTGTAGCTATGGAGAGGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 86, 4: 1201} {0: 1, 1: 0, 2: 0, 3: 16, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!