ID: 1088823741_1088823750

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1088823741 1088823750
Species Human (GRCh38) Human (GRCh38)
Location 11:113476695-113476717 11:113476734-113476756
Sequence CCCCCTCTCCAGAGGCACAAAAC GCAGCCATCTCTGGAGGCACGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!