|
Left Crispr |
Right Crispr |
Crispr ID |
1088873324 |
1088873327 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:113911618-113911640
|
11:113911640-113911662
|
Sequence |
CCGGGGACAAGCAATTTTCCTGC |
CCTCAGCCTCCTGAGTAGCTAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 9, 2: 1374, 3: 37644, 4: 90564} |
{0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|