|
Left Crispr |
Right Crispr |
| Crispr ID |
1088873324 |
1088873329 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:113911618-113911640
|
11:113911648-113911670
|
| Sequence |
CCGGGGACAAGCAATTTTCCTGC |
TCCTGAGTAGCTAGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 1374, 3: 37644, 4: 90564} |
{0: 2479, 1: 61175, 2: 150793, 3: 234901, 4: 202389} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|