ID: 1088896816_1088896831

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1088896816 1088896831
Species Human (GRCh38) Human (GRCh38)
Location 11:114084669-114084691 11:114084715-114084737
Sequence CCCTGTTCCTCCAAGCCCAGATT CTCAAGTTAGAAATCCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 236} {0: 1, 1: 0, 2: 2, 3: 10, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!