ID: 1088900145_1088900153

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1088900145 1088900153
Species Human (GRCh38) Human (GRCh38)
Location 11:114109606-114109628 11:114109643-114109665
Sequence CCTTGCAGAGGCCATCCTCTTAA TTTGAGGGATGAGCAACTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 162} {0: 1, 1: 1, 2: 0, 3: 30, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!