ID: 1088907023_1088907035

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1088907023 1088907035
Species Human (GRCh38) Human (GRCh38)
Location 11:114162704-114162726 11:114162756-114162778
Sequence CCTTATGTGGGGGCGCCTTTGGT ATGGGGGTGGCTCAGAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 49} {0: 1, 1: 0, 2: 1, 3: 35, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!