ID: 1088925916_1088925923

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1088925916 1088925923
Species Human (GRCh38) Human (GRCh38)
Location 11:114302741-114302763 11:114302770-114302792
Sequence CCTCCCAATTTCTGTGTTGAAAT CCCCTTATGATGGTATTAAGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 31, 3: 229, 4: 1139} {0: 1, 1: 0, 2: 19, 3: 178, 4: 813}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!