ID: 1088961364_1088961366

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1088961364 1088961366
Species Human (GRCh38) Human (GRCh38)
Location 11:114669121-114669143 11:114669141-114669163
Sequence CCAGCAAAAATGTGAGAAGCTCT TCTGTGGACCCTCTCCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 193} {0: 1, 1: 0, 2: 3, 3: 21, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!