ID: 1088963204_1088963215

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1088963204 1088963215
Species Human (GRCh38) Human (GRCh38)
Location 11:114691752-114691774 11:114691789-114691811
Sequence CCCAAGGGGGGCTTTGGTGAGCT CTTAGGGGCAGATAGTGCTGAGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 5, 3: 33, 4: 171} {0: 1, 1: 0, 2: 1, 3: 11, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!