ID: 1089016906_1089016920

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1089016906 1089016920
Species Human (GRCh38) Human (GRCh38)
Location 11:115172864-115172886 11:115172909-115172931
Sequence CCCATGACGTGGCCAAGGGAGAA CTGAGGGGATGGTGGGAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 99} {0: 1, 1: 0, 2: 1, 3: 53, 4: 533}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!