ID: 1089042183_1089042193

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1089042183 1089042193
Species Human (GRCh38) Human (GRCh38)
Location 11:115462575-115462597 11:115462613-115462635
Sequence CCCCATGAACCTATTAAATATTC TTTGATGTGGAGGAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 287} {0: 1, 1: 0, 2: 5, 3: 97, 4: 923}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!