ID: 1089096347_1089096353

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1089096347 1089096353
Species Human (GRCh38) Human (GRCh38)
Location 11:115923070-115923092 11:115923090-115923112
Sequence CCTGCGTGAACTCTGCCCTTCTC CTCCCCGGTGGCAATTAGCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!