ID: 1089111145_1089111147

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1089111145 1089111147
Species Human (GRCh38) Human (GRCh38)
Location 11:116057671-116057693 11:116057701-116057723
Sequence CCATCTATATCCTTGCTGATATT TTGTTCTGTCAGTTACTGAGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 9, 3: 46, 4: 385} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!