ID: 1089113963_1089113968

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1089113963 1089113968
Species Human (GRCh38) Human (GRCh38)
Location 11:116079026-116079048 11:116079062-116079084
Sequence CCTAGTCTCCTCTCCATGGTGGC GTCTCATCCCCTGCTCTTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!