ID: 1089169194_1089169203

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1089169194 1089169203
Species Human (GRCh38) Human (GRCh38)
Location 11:116500502-116500524 11:116500538-116500560
Sequence CCGGCCACCTTCGAGTTGCCCAG TTACCCGCAGAAGTCGGCGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!