ID: 1089213823_1089213836

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1089213823 1089213836
Species Human (GRCh38) Human (GRCh38)
Location 11:116823536-116823558 11:116823576-116823598
Sequence CCCACCAACCTCAGCATGGAAGG ACAGTAGGAGAAACACCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 202} {0: 1, 1: 0, 2: 0, 3: 25, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!