ID: 1089227354_1089227357

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1089227354 1089227357
Species Human (GRCh38) Human (GRCh38)
Location 11:116936824-116936846 11:116936852-116936874
Sequence CCTGCATGTGTACTTGCTGTTTC CATGCTGTACACTTTGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 236} {0: 1, 1: 0, 2: 1, 3: 18, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!