ID: 1089275956_1089275969

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1089275956 1089275969
Species Human (GRCh38) Human (GRCh38)
Location 11:117336350-117336372 11:117336384-117336406
Sequence CCAAGAGATTCACAGGAGGGATT CGGTGGGTATGGAGGAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 22, 4: 175} {0: 1, 1: 4, 2: 2, 3: 27, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!