ID: 1089297310_1089297315

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1089297310 1089297315
Species Human (GRCh38) Human (GRCh38)
Location 11:117477887-117477909 11:117477929-117477951
Sequence CCGGCTGCCTTCTCAGTGCTCTG TTAAGAGTGCAAAGCCCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 505} {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!