ID: 1089300449_1089300453

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1089300449 1089300453
Species Human (GRCh38) Human (GRCh38)
Location 11:117495584-117495606 11:117495600-117495622
Sequence CCTTAGGCTTGCCTGGTCTAGCA TCTAGCACACAGCTCTAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90} {0: 1, 1: 0, 2: 2, 3: 10, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!