ID: 1089306225_1089306234

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1089306225 1089306234
Species Human (GRCh38) Human (GRCh38)
Location 11:117527990-117528012 11:117528041-117528063
Sequence CCACCTGCCCTGGTGGAGGTGAT TTGCAGGCAACCAGTAGTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 335} {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!