ID: 1089306227_1089306234

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1089306227 1089306234
Species Human (GRCh38) Human (GRCh38)
Location 11:117527997-117528019 11:117528041-117528063
Sequence CCCTGGTGGAGGTGATAACATTG TTGCAGGCAACCAGTAGTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 159} {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!