ID: 1089321101_1089321107

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1089321101 1089321107
Species Human (GRCh38) Human (GRCh38)
Location 11:117627327-117627349 11:117627360-117627382
Sequence CCTTCCTCACCACCATCTGAGGT TCGCCCTGCCCTGTTTCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 358} {0: 1, 1: 1, 2: 3, 3: 31, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!