ID: 1089325015_1089325020

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1089325015 1089325020
Species Human (GRCh38) Human (GRCh38)
Location 11:117651035-117651057 11:117651053-117651075
Sequence CCTGGGTGGGACCTTGGAGGTCA GGTCATGCCTGTGACCATGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 188} {0: 1, 1: 0, 2: 5, 3: 11, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!