ID: 1089328892_1089328902

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1089328892 1089328902
Species Human (GRCh38) Human (GRCh38)
Location 11:117676509-117676531 11:117676540-117676562
Sequence CCTCTTTTTCCCAAAGGGTCCAG CATTGCCACAACTGCACAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 200} {0: 1, 1: 1, 2: 1, 3: 14, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!