ID: 1089330699_1089330709

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1089330699 1089330709
Species Human (GRCh38) Human (GRCh38)
Location 11:117687026-117687048 11:117687067-117687089
Sequence CCCCATCTCTGCAGAGCTGCAGA GTCTACATGCAGAATGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 35, 4: 384} {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!