ID: 1089333842_1089333848

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1089333842 1089333848
Species Human (GRCh38) Human (GRCh38)
Location 11:117709146-117709168 11:117709182-117709204
Sequence CCTAGTTTCAATGTGTGACCCTG ATCATGAAACAAGTGTGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 205} {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!