ID: 1089346743_1089346751

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1089346743 1089346751
Species Human (GRCh38) Human (GRCh38)
Location 11:117796152-117796174 11:117796182-117796204
Sequence CCTCCCGATCCCGGCTGCCTCGC GTACGCAGCGCCCCAGCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 220} {0: 1, 1: 0, 2: 1, 3: 2, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!