ID: 1089346974_1089346991

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1089346974 1089346991
Species Human (GRCh38) Human (GRCh38)
Location 11:117796962-117796984 11:117797005-117797027
Sequence CCCCGCCTCGCCGCCAGCCGCGC CGCCGCCCAGCCGCCCGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 81, 4: 474} {0: 1, 1: 0, 2: 6, 3: 37, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!