ID: 1089350045_1089350057

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1089350045 1089350057
Species Human (GRCh38) Human (GRCh38)
Location 11:117816995-117817017 11:117817022-117817044
Sequence CCCTCCTGCCCCCATGCCCACAG CTTTCTCTGGAGCTGCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 93, 4: 735} {0: 1, 1: 0, 2: 3, 3: 18, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!