ID: 1089352441_1089352450

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1089352441 1089352450
Species Human (GRCh38) Human (GRCh38)
Location 11:117829155-117829177 11:117829182-117829204
Sequence CCCTGGCACGGCCACCCCAACGT ACTGAGAAGCAGAGTTAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90} {0: 1, 1: 0, 2: 1, 3: 38, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!