ID: 1089354680_1089354689

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1089354680 1089354689
Species Human (GRCh38) Human (GRCh38)
Location 11:117841922-117841944 11:117841952-117841974
Sequence CCCTACCCCTCCTGCCAGGCAGG TCCCCCTGACCCCTGCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 372} {0: 1, 1: 0, 2: 4, 3: 71, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!