ID: 1089363590_1089363591

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1089363590 1089363591
Species Human (GRCh38) Human (GRCh38)
Location 11:117907469-117907491 11:117907482-117907504
Sequence CCATAATTAATGTGCGAGGAAAC GCGAGGAAACACCAGCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100} {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!