ID: 1089385854_1089385859

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1089385854 1089385859
Species Human (GRCh38) Human (GRCh38)
Location 11:118067401-118067423 11:118067416-118067438
Sequence CCTGGTTGCCTAAGGTAGGGTGA TAGGGTGAACTGGCCCAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 83, 3: 151, 4: 233} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!