ID: 1089393082_1089393096

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1089393082 1089393096
Species Human (GRCh38) Human (GRCh38)
Location 11:118115253-118115275 11:118115298-118115320
Sequence CCCGGAAGGGGGTGTGGACACCT CATGGGGAGTTCTAAGAATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 172} {0: 1, 1: 0, 2: 2, 3: 8, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!