ID: 1089400010_1089400025

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1089400010 1089400025
Species Human (GRCh38) Human (GRCh38)
Location 11:118159001-118159023 11:118159053-118159075
Sequence CCCACGTCCCCACCACTGATAGA ACAGGGGTATAGAGGGGACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!