ID: 1089433199_1089433204

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1089433199 1089433204
Species Human (GRCh38) Human (GRCh38)
Location 11:118438565-118438587 11:118438591-118438613
Sequence CCAGCCGTTTCCTGCGTGCTCTG TTGGTGCACACAAAATATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138} {0: 1, 1: 0, 2: 0, 3: 17, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!