ID: 1089438279_1089438285

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1089438279 1089438285
Species Human (GRCh38) Human (GRCh38)
Location 11:118491071-118491093 11:118491114-118491136
Sequence CCATGCTGGTGTTCATGATCCCA GGGTTGGTAAATGCAAGTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163} {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!