ID: 1089462220_1089462224

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1089462220 1089462224
Species Human (GRCh38) Human (GRCh38)
Location 11:118659964-118659986 11:118659997-118660019
Sequence CCTGGGGCAGTGCTGCCTTTAGA AGTGCCCTGCCTGCTGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 203} {0: 1, 1: 0, 2: 9, 3: 45, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!