ID: 1089474822_1089474826

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1089474822 1089474826
Species Human (GRCh38) Human (GRCh38)
Location 11:118750811-118750833 11:118750840-118750862
Sequence CCTTGCTCTCTCTGGTAAACCTA AGGTACTAGATGAGACAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 178} {0: 2, 1: 0, 2: 1, 3: 11, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!