ID: 1089476147_1089476152

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1089476147 1089476152
Species Human (GRCh38) Human (GRCh38)
Location 11:118764439-118764461 11:118764474-118764496
Sequence CCCATAGCAAACAACTTTGTACC TTTACCCAACTTTTTTCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100} {0: 1, 1: 0, 2: 0, 3: 43, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!