ID: 1089480798_1089480807

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1089480798 1089480807
Species Human (GRCh38) Human (GRCh38)
Location 11:118803449-118803471 11:118803495-118803517
Sequence CCCCGTGACCAGGACCAGGACAC ATCCAGCTGTGTCACCTATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!