ID: 1089494018_1089494033

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1089494018 1089494033
Species Human (GRCh38) Human (GRCh38)
Location 11:118899507-118899529 11:118899547-118899569
Sequence CCCTGTAGGGAATAGAAGACAGG CCCAGCTCGGGGAGGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 198} {0: 1, 1: 0, 2: 4, 3: 32, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!